SCCmec typing
SCCmec types can be determined by dentifying specific genes or gene alleles that are required for classification by PCR. We recommend to determine the type of ccr and class of mec first, then to investigate differences in J regions. The following PCR methods have been reported.
I. SCCmec type assignment
1. PCRs for assigning ccr types
The ccr type could be determined by identifying ccr genes, which are located in the midst of the ccr gene complex.
(1) Identification of ccr1, ccr2, ccr3(Ito et al. 2001, Okuma et al. 2002)
A multiplex PCR to identify three gene alleles in a reaction with a primer common to three ccrB genes (ccrB1, ccrB2, and ccrB3), and three primers that are specific to each ccrA1, ccrA2, ccrA3 gene, respectively.
(2) Identification of ccr1, ccr2, ccr3, ccr5(ccrC) (Zhang et al. 2005)。
A multiplex PCR with a primer pair to identify ccrC and primers used in (1).
(3) Identification of ccr1, ccr2, ccr3, ccr4, and ccr5 (ccrC) (Kondo et al. in press).
A multiplex PCR with two primer pairs to identify ccr4 and ccrC, and primers used in (1).
2.PCRs for assigning mec classes
The mec classes can be determined by identifying genes or gene alleles comprising a mec gene complex, e.g., mecA, mecR1, mecI, IS431, and IS1272. (1) Traditional PCR to identify each gene or gene allele (Okuma et al.2002).
(1) Traditional PCR to identify each gene or gene allele (Okuma et al.2002. Hisata et al. 2005. Chongtracool et al. 2006)
(2) A multiplex PCR to identify mec classes A and B(Zhang et al. 2005)
(3) A multiplex PCR to identify mec classes A, B, and C(Kondo et al. in press)
3. Decision of SCCmec type
The type of SCCmec is decided upon the type of ccr and class of mec, that are obtained by PCR.
| ccr | mec | combination of ccr and mec | SCCmec type |
| type 1 | class B | 1B | Type I |
| type 2 | class A | 2A | Type II |
| type 3 | class A | 3A | Type III |
| type 2 | class B | 2B | Type IV |
| type 5 | class C | 5C | Type V |
| type 4 | class B | 4B | Type VI |
II. Subtyping of SCCmec elements based on the structural differences in J regions
PCRs to identify specific ORFs in J1 regions or to identify integrated copy of drug resistance plasmids or transposons, that are mostly integrated at J2 and J3 regions of SCCmec elements, have been reported.
1. PCRs for assigning J region differences
(1) Multiplex PCR (Oliveira et al. 2001)
The first multiplex PCR for assignment of SCCmec elements. The multiplex PCR can identify ORFs locate at J1 region of type-I.1 SCCmec and type-II.1.
(2) PCRs with pairs of primers specific to ORFs in J1 regions(Okuma et al.2002. Ma et al. 2005. Hisata et al. 2005)
Traditional PCR to identify specific regions locate at J1 region of SCCmec elements, e.g., type-II.1, type-II.2, type-IV.1, type-IV.2, type-IV.3, and type-IV.4.
(3) Multiplex PCR (Zhang et al. 2005)
A multiplex PCR to identify ORFs locate at J1 region of type-I.1, type-II.1, type-IV.1, type-IV.2, and type-IV.4 SCCmec elements. Note that a primer pair to identify type-III.1 SCCmec is designed on SCCmercury, and a primer pair to identify type-IV.3 SCCmec is designed on the outside of SCCmec designated IE25923.
(4) Multiplex PCR #3 (Kondo et al. in press)
A multiplex PCR to identify ORFs locate at J1 region of type I.1, type IV.1, type IV.2, type IV.3, type IV.4 SCCmec elements.
(5) Muliplex PCR #4 (Kondo et al. in press)
A multiplex PCR to identify ORFs locate at J1 region of type II.1, type II.2, type II.3, type II.4, type III.1, type V.1 SCCmec elements.
(6) Multiplex PCR#5 (Kondo et al. in press)
A multiplex PCR to identify transposons Tn554 and ΨTn554 at the J2 region of type II and type-III SCCmec elements.
(7) Multiplex PCR#6 (Kondo et al. in press)
A multiplex PCR to identify plasmids pUB110 and pT181, which integrated downstream of mecA.
2. Description of SCCmec subtypes
II. Primers used for PCR
Primers and reactions used for each PCR are listed
1. PCRs to identify ccr
| objective | Primers (previous name) | Nucleotide sequence (5'-3') | gene[s] reactive to the primer | Expected size of product (amplified DNA fragments of ) | PCR method | Comments |
| (1) Identification of ccr1, ccr2, ccr3 (Ito et al. 2001) | ßc (ß2) | ATTGCCTTGATAATAGCCITCT | ccrB1, ccrB2, and ccrB3 | A | The letter "I" in the nucleotide sequence of βc, signify inosine. A ccr type is determined by PCR using primer ßc (the common primer for three types of ccrB) and either one of the three types of ccrA, α1 (ccrA1), α2 (ccrA2), and α3 (ccrA3). This typing actually reflects the allotype of ccrA. | |
| α1 (α2) | AACCTATATCATCAATCAGTACGT | ccrA1 | 695 bp (ccrA1-ccrB1) | |||
| α2 (α3) | TAAAGGCATCAATGCACAAACACT | ccrA2 | 937 bp (ccrA2-ccrB2) | |||
| α3 (α4) | AGCTCAAAAGCAAGCAATAGAAT | ccrA3 | 1791 bp (ccrA3-ccrB3) | |||
| (2) Identification of ccr1, ccr2, ccr3, ccr5 (ccrC) (Zhang et al. 2005) | ccrAB-ß2 | the same as bc(b2) | ccrB1, ccrB2, and ccrB3 | C | ||
| ccrAB-2 | the same as α1 (α2) | ccrA1 | 695 bp (ccrA1-ccrB1) | |||
| ccrAB-3 | the same as α2 (α3) | ccrA2 | 937 (ccrA2-ccrB2) | |||
| ccrAB-4 | the same as α3 (α4) | ccrA3 | 1791 bp (ccrA3-ccrB3) | |||
| ccrC-F | ATGAATTCAAAGAGCATGGC | ccrC | 336 bp (ccrC) | |||
| ccrC-R | GATTTAGAATTGTCGTGATTGC | ccrC | ||||
| (3) Identification of ccr1, ccr2, ccr3, ccr4, and ccr5 (ccrC) (Kondo et al. in press) | mA1 | TGCTATCCACCCTCAAACAGG | mecA | 286 bp (mecA) | D | |
| mA2 | AACGTTGTAACCACCCCAAGA | mecA | ||||
| α1 | AACCTATATCATCAATCAGTACGT | ccrA1 | 695 bp (ccrA1-ccrB1) | |||
| α2 | TAAAGGCATCAATGCACAAACACT | ccrA2 | 937 bp (ccrA2-ccrB2) | |||
| α3 | AGCTCAAAAGCAAGCAATAGAAT | ccrA3 | 1791 bp (ccrA3-ccrB3) | |||
| βc | ATTGCCTTGATAATAGCCITCT | ccrB1, ccrB2, and ccrB3 | ||||
| α4.2 | GTATCAATGCACCAGAACTT | ccrA4 | 1287 bp (ccrA4-ccrB4) | |||
| β4.2 | TTGCGACTCTCTTGGCGTTT | ccrB4 | ||||
| γR | CCTTTATAGACTGGATTATTCAAAATAT | ccrC | 518 bp (ccrC) | |||
| γF | CGTCTATTACAAGATGTTAAGGATAAT | ccrC |
2.PCRs to identify mec classes
| Objective | Primers (previous name) | Nucleotide sequence (5'-3') | gene[s] reactive to the primer | Expected size of product (amplified DNA fragments of ) | PCR method | Comments |
| (1) PCRs to identify each gene or gene allele (Okuma et al.2002. Hisata et al. 2005. Chongtracool et al. 2006) | ||||||
| mecA | mA1 | TGCTATCCACCCTCAAACAGG | mecA | 286 bp (mecA) | A | |
| mA2 | AACGTTGTAACCACCCCAAGA | mecA | ||||
| class A mec | mI4 | CAAGTGAATTGAAACCGCCT | mecI | 187 bp (mecI for class A mec) | A | |
| mI3 | CAAAAGGACTGGACTGGAGTCCAAA | mecI | ||||
| mcR2 | CGCTCAGAAATTTGTTGTGC | mecR1(PB) | 319 bp (PB domein of mecR1 for class A mec) | |||
| mcR5 | CAGGGAATGAAAATTATTGGA | mecR1(PB) | ||||
| class A mec | mI4 | CAAGTGAATTGAAACCGCCT | mecI | 1920 bp (mecI-mecR1 for class A mec) | A | |
| mcR3 | GTCTCCACGTTAATTCCATT | mecR1 | ||||
| class B mec | IS5 | AACGCCACTCATAACATATGGAA | IS1272 | 1996 bp, IS5 (mecA-IS1272 for class B mec) | A | |
| mA6 | TATACCAAACCCGACAAC | mecA | ||||
| class C mec | IS2 (iS-2) | TGAGGTTATTCAGATATTTCGATGT | IS431mec | 2072 bp, IS2 (mecA-IS431 for class C mec) | A | |
| mA2 | AACGTTGTAACCACCCCAAGA | mecA | ||||
| (2) A multiplex PCR to identify mec classes, A and B (Zhang et al. 2005) | mecI-F | CCCTTTTTATACAATCTCGTT | mecI | 146 bp (mecI for class A mec) | C | |
| mecI-R | ATATCATCTGCAGAATGGG | mecI | ||||
| IS1272-F | TATTTTTGGGTTTCACTCGG | IS1272 | 1305 bp (IS1272-mecR1 for class B mec) | |||
| mecR1-R | CTCCACGTTAATTCCATTAATACC | mecR1 | ||||
| (3) A multiplex PCR to identify mec classes, A, B, and C (Kondo et al. in press) | mI6 | CATAACTTCCCATTCTGCAGATG | mecI | 1963 bp (mecA-mecI for class A mec) | E | |
| IS7 | ATGCTTAATGATAGCATCCGAATG | IS1272 in the upstream of mecA | 2827 bp (mecA-IS1272 for class B mec) | |||
| IS2(iS-2) | TGAGGTTATTCAGATATTTCGATGT | IS431in the upstream of mecA | 804 bp (mecA-IS431 for class C mec) | |||
| mA7 | ATATACCAAACCCGACAACTACA | mecA | ||||
3. Subtyping of SCCmec elements based on the structural differences in J regions
| Objective | Primer | Oligonucleotide sequence (5'-3') | Specificity or gene[s ]reactive to primers | Expected size of product (amplified DNA fragments of ) | PCR method | comments |
| (1) Multiplex PCR (Oliveira et al. 2001) | CIF2 F2 | TTCGAGTTGCTGATGAAGAAGG | I | 495 bp | B | Locus A |
| CIF2 R2 | ATTTACCACAAGGACTACCAGC | |||||
| KDP F1 | AATCATCTGCCATTGGTGATGC | II | 284 bp | Locus B | ||
| KDP R1 | CGAATGAAGTGAAAGAAAGTGG | |||||
| MECI P2 | ATCAAGACTTGCATTCAGGC | II, III | 209 bp | Locus C | ||
| MECI P3 | GCGGTTTCAATTCACTTGTC | |||||
| DCS F2 | CATCCTATGATAGCTTGGTC | I, II, IV | 342 bp | Locus D | ||
| DCS R1 | CTAAATCATAGCCATGACCG | |||||
| RIF4 F3 | GTGATTGTTCGAGATATGTGG | III | 243 bp | Locus E | ||
| RIF4 R9 | CGCTTTATCTGTATCTATCGC | |||||
| RIF5 F10 | TTCTTAAGTACACGCTGAATCG | III | 414 bp | Locus F | ||
| RIF5 R13 | GTCACAGTAATTCCATCAATGC | |||||
| IS431 P4 | CAGGTCTCTTCAGATCTACG | 381 bp | Locus G | |||
| pUB110 R1 | GAGCCATAAACACCAATAGCC | |||||
| IS431 P4 | CAGGTCTCTTCAGATCTACG | 303 bp | Locus H | |||
| pT181 R1 | GAAGAATGGGGAAAGCTTCAC | |||||
| MECA P4 | TCCAGATTACAACTTCACCAGG | Internal control | 162 bp | mecA | ||
| MECA P7 | CCACTTCATATCTTGTAACG | |||||
| (2) PCRs with pairs of primers specific to ORFs in J1 regions(Okuma et al.2002. Ma et al. 2005. Hisata et al. 2005) | 2a1 | ATGTCAGAGCTTTCTAACTTAGTCA | IIa | 456 bp | A | |
| 2a2 | TGAAAATGAAAGCCGTGCCG | |||||
| 2b1 | AGCAATTTTTTCTCCTTCTGCTA | II b | 846 bp | |||
| 2b2 | TTATTAGATCAAGAGCCAAGTG | |||||
| 4a1 | TTTGAATGCCCTCCATGAATAAAAT | IVa | 458 bp | |||
| 4a2 | AGAAAAGATAGAAGTTCGAAAGA | |||||
| 4b1 | AGTACATTTTATCTTTGCGTA | IVb | 994 bp | |||
| 4b2 | AGTCATCTTCAATATCGAGAAAGTA | |||||
| 4c1 | TCTATTCAATCGTTCTCGTATTT | IVc | 678 bp | |||
| 4c2 | TCGTTGTCATTTAATTCTGAACT | |||||
| 4d1 | TTTGAGAGTCCGTCATTATTTCTT | IVd | 1010 bp | |||
| 4d2 | AGAATGTGGTTATAAGATAGCTA | |||||
| (3) Multiplex PCR (Zhang et al. 2005) | Type I-F | GCTTTAAAGAGTGTCGTTACAGG | SCCmec I | 613 bp | C | *Note that a primer pair to identify type-III.1 SCCmec is designed on SCCmercury, and a primer pair to identify type-IV.3 SCCmec is designed on the outside of SCCmec designated IE25923. |
| Type I-R | GTTCTCTCATAGTATGACGTCC | |||||
| Type II-F | CGTTGAAGATGATGAAGCG | SCCmec II | 398 bp | |||
| Type II-R | CGAAATCAATGGTTAATGGACC | |||||
| Type III-F | CCATATTGTGTACGATGCG | SCCmec III | 280 bp | |||
| Type III-R | CCTTAGTTGTCGTAACAGATCG | |||||
| Type IVa-F | GCCTTATTCGAAGAAACCG | SCCmec IVa | 776 bp | |||
| Type IVa-R | CTACTCTTCTGAAAAGCGTCG | |||||
| Type IVb-F | TCTGGAATTACTTCAGCTGC | SCCmec IVb | 493 bp | |||
| Type IVb-R | AAACAATATTGCTCTCCCTC | |||||
| Type IVc-F | ACAATATTTGTATTATCGGAGAGC | SCCmec IVc | 200 bp | |||
| Type IVc-R | TTGGTATGAGGTATTGCTGG | |||||
| Type IVd-F5 | CTCAAAATACGGACCCCAATACA | SCCmec IVd | 881 bp | |||
| Type IVd-R6 | TGCTCCAGTAATTGCTAAAG | |||||
| Type V-F | GAACATTGTTACTTAAATGAGCG | SCCmec V | 325 bp | |||
| Type V-R | TGAAAGTTGTACCCTTGACACC | |||||
| (4) Multiplex PCR #3 (Kondo et al. in press) | 1a3 | TTTAGGAGGTAATCTCCTTGATG | Type-I.1 SCCmec | 154 bp (E007 in Type-I.1 SCCmec) | E | |
| 1a4 | TTTTGCGTTTGCATCTCTACC | |||||
| 4al | TTTGAATGCCCTCCATGAATAAAAT | Type IV.1 (IVa) SCCmec | 458 bp (CQ002 in Type IV.1 (IVa) SCCmec) | |||
| 4a3 | AGAAAAGATAGAAGTTCGAAAGA | |||||
| 4b3 | AACCAACAGTGGTTACAGCTT | Type IV.2 (IVb) SCCmec | 726 bp ( M001 in Type IV.2 (IVb) SCCmec) | |||
| 4b4 | CGGATTTTAGACTCATCACCAT | |||||
| 4c4 | AGGAAATCGATGTCATTATAA | Type IV.3(IVc) SCCmec | 259 bp(CR008 in Type IV.3(IVc) SCCmec | |||
| 4c5 | ATCCATTTCTCAGGAGTTAG | |||||
| 4d3 | AATTCACCCGTACCTGAGAA | Type IV.4(IVd) SCCmec | 1242 bp (CD002 in Type IV.4(IVd) SCCmec) | |||
| 4d4 | AGAATGTGGTTATAAGATAGCTA | |||||
| (5) Muliplex PCR #4 (Kondo et al. in press) | kdpB1 | GATTACTTCAGAACCAGGTCAT | KdpB in Type II.1 SCCmec | 287 bp (KdpB in Type II.1 SCCmec) | E | |
| kdpB2 | TAAACTGTGTCACACGATCCAT | |||||
| 2b3 | GCTCTAAAAGTTGGATATGCG | S01 in Type II.2 SCCmec | 1518 bp (S01 in Type II.2 SCCmec) | |||
| 2b4 | TGGATTGAATCGACTAGAATCG | |||||
| 4b3 | AACCAACAGTGGTTACAGCTT | IIE03 in type II.3 (IIE) SCCmec and M001 in Type IV.2 (IVb) SCCmec | 726 bp ( IIE03 in type II.3 (IIE) SCCmec and M001 in Type IV.2 (IVb) SCCmec) |
|||
| 4b4 | CGGATTTTAGACTCATCACCAT | |||||
| II4-3 | GTACCGCTGAATATTGATAGTGAT | RN06 in Type-II.4 SCCmec | 2003 bp (RN06 in Type-II.4 SCCmec) | |||
| II4-1 | ACTCTAATCCTAATCACCGAAC | |||||
| 3a1 | ATGGCTTCAGCATCAATGAG | Z004 in type-III.1 SCCmec | 503 bp (Z004 in type-III.1 SCCmec) | |||
| 3a2 | ATATCCTTCAAGCGCGTTTC | |||||
| 5a1 | ACCTACAGCCATTGCATTATG | V024 in type-V SCCmec | 1159 bp (V024 in type-V SCCmec) | |||
| 5a2 | TGTATACATTTCGCCACTAGCT | |||||
| (6) Multiplex PCR#5 (Kondo et al. in press) | ermA1 | TGAAACAATTTGTAACTATTGA | ermA | 2756 bp (ermA-ORFs (CN030 and CZ021) in J2 region of type-II.1 and III.1 SCCmec) | E | |
| cad4 | ATTGCGATTCTTTCCGATATGG | cadB | 1540 bp (cadB- ORFs (CN030 and CZ021) in J2 region of type-II.1 and III.1 SCCmec) | |||
| mN5 | TTGCTTCGGGACTTACCTCTAGT | ORFs (CN030 and CZ021) in J2 region of type-II.1 and III.1 SCCmec | ||||
| (7) Multiplex PCR#6 (Kondo et al. in press) | ant1 | CAGACCAATCAACATGGCACC | ant(4)' in pUB110 | 4952 bp (mecA-ant(4)') | F | |
| pT181-2 | AGGTTTATTGTCACTACAATTGA | tetK in pT181 | 7406 bp (mecA-tetK) | |||
| mA1 | TGCTATCCACCCTCAAACAGG | mecA |
PCR
A.The method at the early stage
All PCR reactions were carried out in a GeneAmp PCR system 9600 (Perkin Elmer,
The method now used at Department of Bacteriology,
1. Prepare the pre-mixture and aliquot to each tube. Pre-mixture should contain the following components in a volume of 49 mL per aliquot: 5 mL 10 x commercial reaction buffer containing MgCl2, 250 mM of each dNTP, 2-4 oligonucleotide primers (0.1 mM), Taq DNA polymerase (1 unit), and DEPC-H2O to adjust the final volume to 49 mL.
2. Add 1 mL of template DNA to each tube and subject to PCR.
3. The PCR conditions are: denaturation (94 °C, 1 min), 30 cycles of denaturation (94 °C, 1 min), annealing (50 °C, 30 sec or 1 min), and extension (72 °C, 2 min). Keep samples at 4 °C following PCR.
4. Mount the agarose gel in the electrophoresis tank, and add enough 1x TAE buffer to cover the gel.
5. Mix 4 mL sample from each PCR reaction with 1 mL loading buffer and load samples into the wells of the gel. The gel is usually run at high voltage (100V). Stop running at appropriate time. Usually, we stop the procedure when the bromophenol blue has run 2/3 of the gel length.
6. DNA fragments in the agarose gel are stained by soaking in 0.01% Ethidium Bromide solution for 20 min.
7. Take a photograph using transmitted UV light with Fas II (UV sample camera, Toyobo,
B. Multiplex PCR (Oliveira et al. 2001)
The multiplex PCR was performed in a 50-µl volume with the GeneAmp PCR kit (Applied Biosystems, Foster City, Calif.) containing the following: 1x PCR buffer II; 200 µM (each) deoxynucleoside triphosphate; 400 nM concentrations of primers CIF2 F2, CIF2 R2, MECI P2, MECI P3, RIF5 F10, RIF5 R13, pUB110 R1, and pT181 R1; 800 nM concentrations of primers DCS F2, DCS R2, MECA P4, MECA P7, and IS431 P4; 200 nM concentrations of primers KDP F1, KDP R1, RIF4 F3, and RIF4 R9; 1.25 U of AmpliTaq; and approximately 5 ng of template DNA. PCR amplifications were performed in a DNA Thermal Cycler 480 (Applied Biosystems) with the following parameters: predenaturation for 4 min at 94°C; 30 cycles of 94°C for 30 s, 53°C for 30 s, and 72°C for 1 min; postextension for 4 min at 72°C; and soaking at 4°C. PCR products (10 µl) were resolved in a 2% SeaKem LE (BioWhittaker Molecular Applications, Rockland, Maine) agarose gel in 0.5x Tris-borate-EDTA buffer (Bio-Rad, Hercules, Calif.) at 100 V and visualized with ethidium bromide.
C. Multiplex PCR (Zhang et al. 2005)
All PCR assays were performed directly from bacterial suspensions obtained after the rapid DNA extraction method. An aliquot of 2 µl of this suspension was added to 23 µl of PCR mixture containing 50 mM KCl, 20 mM Tris-HCl (pH 8.4), 2.5 mM MgCl2, 0.2 mM of each deoxynucleoside triphosphate (dATP, dUTP, dGTP, and dCTP) (Invitrogen Inc., Carlsbad, CA), various concentrations of the respective primers (Table 2), and 1.0 unit of Platinum Taq DNA polymerase (Invitrogen Inc., Carlsbad, CA).
The amplification was performed in a GeneAmp PCR system 9700 or 9600 Thermal Cycler (Applied Biosystems, Foster City, CA) beginning with an initial denaturation step at 94°C for 5 min followed by 10 cycles of 94°C for 45 seconds, 65°C for 45 seconds, and 72°C for 1.5 min and another 25 cycles of 94°C for 45 seconds, 55°C for 45 seconds, and 72°C for 1.5 min, ending with a final extension step at 72°C for 10 min and followed by a hold at 4°C. For the single target amplification, PCR was run in 23 µl of PCR mixture but containing 0.2 µM of each primer, with cycling parameters beginning with an initial denaturation step at 94°C for 5 min followed by 30 cycles of 94°C for 1 min, 50°C for 1 min, and 72°C for 2 min, ending with a final extension step at 72°C for 10 min. All PCR assay runs incorporated a reagent control (without template DNA). The PCR amplicons were visualized using a UV light box after electrophoresis on a 2% agarose gel containing 0.5 µg/ml ethidium bromide.
D. M-PCR#1 (M-PCR for identification of ccr) (Kondo et al. in press)
Reaction mixtures contained 10 ng chromosomal DNA, oligonucleotide primers (0.1 mM), 200 mM each dNTPs, Ex Taq buffer, and 2.5 U Ex Taq polymerase (Takara Bio Inc., Kyoto, Japan) in a final volume of 50 ml. The concentration of MgCl2 was 3.2 mM. A Takara PCR Thermal Cycler was used for amplification with an initial denaturation step (94°C, 2 min); 30 cycles of denaturation (94°C, 2 min), annealing (57°C, 1min), extension (72°C, 2 min); and a final elongation at 72°C for 2 min. PCR products were electrophoresed in a 1% agarose-gel with 1 X TAE buffer at 100V for approximately 30 min. The DNA fragments were stained by soaking the agarose gel in 0.01% ethidium bromide solution for 20 min and were visualized using a UV transilluminator.
E. For M-PCR#2-5 (M-PCR for identification of mec and J regions) (Kondo et al. in press)
Reaction mixtures contained 10 ng chromosomal DNA, oligonucleotide primers (0.1 mM), 200 mM each dNTPs, Ex Taq buffer, and 2.5 U Ex Taq polymerase (Takara Bio Inc., Kyoto, Japan) in a final volume of 50 ml. The concentration of MgCl2 was 2.0 mM. A Takara PCR Thermal Cycler was used for amplification with an initial denaturation step (94°C, 2 min); 30 cycles of denaturation (94°C, 2 min), annealing (60°C, 1min), extension (72°C, 2 min); and a final elongation at 72°C for 2 min. PCR products were electrophoresed in a 1% agarose-gel with 1 X TAE buffer at 100V for approximately 30 min. The DNA fragments were stained by soaking the agarose gel in 0.01% ethidium bromide solution for 20 min and were visualized using a UV transilluminator.
F. M-PCR#6 (Kondo et al. in press)
M-PCR#6, we performed long-range PCR using the Expand High Fidelity PCR system following the manufacturer’s recommendations (Roche Diagnostics Co. Indianapolis, IN, USA). Briefly, reactions were performed in a final volume of 50 ml and contained 10 ng template DNA, oligonucleotide primers (0.3 mM), 200 ml of each dNTP, 1x Expand High Fidelity buffer, 1.5 mM MgCl2 , and 2.6 U Expand High Fidelity PCR system enzyme mix. The PCR consisted of denaturation (94°C, 2 min); 10 cycles of denaturation (94°C, 15 s), annealing (50°C, 30 s), and extension (68°C, 8 min); 20 cycles of denaturation (94°C, 15 s), annealing (50°C, 30 s), and extension (68°C, 12 min); and final elongation (72°C, 7 min).
PCR products were electrophoresed in a 1% agarose-gel with 1 X TAE buffer at 100V for approximately 30 min. The DNA fragments were stained by soaking the agarose gel in 0.01% ethidium bromide solution for 20 min and were visualized using a UV transilluminator.